pyrosequencing primer Search Results


90
Pyrosequencing Inc universal 16s rrna primers
Universal 16s Rrna Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/universal 16s rrna primers/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
universal 16s rrna primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc reverse primers r4
Reverse Primers R4, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primers r4/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
reverse primers r4 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc pyrosequencing extension primers
Pyrosequencing Extension Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pyrosequencing extension primers/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
pyrosequencing extension primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primer for dhfr codon 108
Primer For Dhfr Codon 108, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer for dhfr codon 108/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primer for dhfr codon 108 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primer 5'-ggtctacccttggacc3
Primer 5' Ggtctacccttggacc3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5'-ggtctacccttggacc3/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primer 5'-ggtctacccttggacc3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc reverse primers r1, r2, r3, r4
Reverse Primers R1, R2, R3, R4, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primers r1, r2, r3, r4/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
reverse primers r1, r2, r3, r4 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primer analyzing eight cpgs in the promoter of gstp1
Primer Analyzing Eight Cpgs In The Promoter Of Gstp1, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer analyzing eight cpgs in the promoter of gstp1/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primer analyzing eight cpgs in the promoter of gstp1 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc qmsp taqman probe and primer set
Qmsp Taqman Probe And Primer Set, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qmsp taqman probe and primer set/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
qmsp taqman probe and primer set - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primers of 13 genes
Primers Of 13 Genes, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers of 13 genes/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primers of 13 genes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc gr_meth_1.3_s sequencing primer
Gr Meth 1.3 S Sequencing Primer, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gr_meth_1.3_s sequencing primer/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
gr_meth_1.3_s sequencing primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
BIOTAGE pyrosequencing primers
Pyrosequencing Primers, supplied by BIOTAGE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pyrosequencing primers/product/BIOTAGE
Average 90 stars, based on 1 article reviews
pyrosequencing primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3
Biotinylated Reverse Primer Tcctgtacctggtttgactg Seq Id No. 3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results