90
|
Pyrosequencing Inc
universal 16s rrna primers Universal 16s Rrna Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/universal 16s rrna primers/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
universal 16s rrna primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
reverse primers r4 Reverse Primers R4, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primers r4/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
reverse primers r4 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
pyrosequencing extension primers Pyrosequencing Extension Primers, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pyrosequencing extension primers/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
pyrosequencing extension primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primer for dhfr codon 108 Primer For Dhfr Codon 108, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer for dhfr codon 108/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primer for dhfr codon 108 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primer 5'-ggtctacccttggacc3 Primer 5' Ggtctacccttggacc3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5'-ggtctacccttggacc3/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primer 5'-ggtctacccttggacc3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
reverse primers r1, r2, r3, r4 Reverse Primers R1, R2, R3, R4, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primers r1, r2, r3, r4/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
reverse primers r1, r2, r3, r4 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primer analyzing eight cpgs in the promoter of gstp1 Primer Analyzing Eight Cpgs In The Promoter Of Gstp1, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer analyzing eight cpgs in the promoter of gstp1/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primer analyzing eight cpgs in the promoter of gstp1 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
qmsp taqman probe and primer set Qmsp Taqman Probe And Primer Set, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qmsp taqman probe and primer set/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
qmsp taqman probe and primer set - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primers of 13 genes Primers Of 13 Genes, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers of 13 genes/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primers of 13 genes - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
gr_meth_1.3_s sequencing primer Gr Meth 1.3 S Sequencing Primer, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gr_meth_1.3_s sequencing primer/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
gr_meth_1.3_s sequencing primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
BIOTAGE
pyrosequencing primers Pyrosequencing Primers, supplied by BIOTAGE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pyrosequencing primers/product/BIOTAGE Average 90 stars, based on 1 article reviews
pyrosequencing primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3 Biotinylated Reverse Primer Tcctgtacctggtttgactg Seq Id No. 3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
biotinylated reverse primer tcctgtacctggtttgactg seq id no. 3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |